View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10163A_low_141 (Length: 245)

Name: NF10163A_low_141
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10163A_low_141
NF10163A_low_141
[»] chr1 (5 HSPs)
chr1 (5-212)||(9804675-9804882)
chr1 (97-240)||(9817550-9817693)
chr1 (94-233)||(9817438-9817577)
chr1 (104-212)||(9817341-9817448)
chr1 (1-36)||(9817777-9817812)
[»] scaffold0432 (3 HSPs)
scaffold0432 (90-240)||(11558-11708)
scaffold0432 (94-212)||(11467-11585)
scaffold0432 (1-33)||(11788-11820)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 5 - 212
Target Start/End: Complemental strand, 9804882 - 9804675
Alignment:
Q  5 tttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactggtcgatgtcgatctcagtgaagtttcatggttcttttttct 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  9804882 tttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactgatcgatgtcgatctcagtgaagtttcatggttcttttttct 9804783  T
Q  105 gatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaatgagga 204  Q
    |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  9804782 gatcgatgtcgatctcagtgatggtgcttggagagaggttggcaacagcgattgagggagaaaattgtgtttagggtttcaagagaatgagaaatgagga 9804683  T
Q  205 tgggagga 212  Q
    ||||||||    
T  9804682 tgggagga 9804675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 97 - 240
Target Start/End: Complemental strand, 9817693 - 9817550
Alignment:
Q  97 ttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgaga 196  Q
    ||||||||||||||||||||||||||  ||| || |||||||||||||| ||||||||  |||||| ||||||| ||||||||||||||||| |||||||    
T  9817693 ttttttctgatcgatgtcgatctcagcaatgttggtaggagagaggttgtcaacggcggatgagggggaaaattgtgtttagggtttcaagataatgaga 9817594  T
Q  197 aatgaggatgggaggattattttgtttgattgatgtccatctca 240  Q
    |||||||||||||||||| |||||||||||||||||| ||||||    
T  9817593 aatgaggatgggaggattcttttgtttgattgatgtcgatctca 9817550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 94 - 233
Target Start/End: Complemental strand, 9817577 - 9817438
Alignment:
Q  94 ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg 193  Q
    ||||||| | |||| |||||||||||||   |||||| ||||||||||||||||| | |||  |||||||||||| ||||||||||||||||| ||||||    
T  9817577 ttcttttgtttgattgatgtcgatctcacctatggtggtaggagagaggttggcagcagcggctgagggagaaaactttgtttagggtttcaaaagaatg 9817478  T
Q  194 agaaatgaggatgggaggattattttgtttgattgatgtc 233  Q
    |||||||||||| |||||||| ||||| ||||| ||||||    
T  9817477 agaaatgaggattggaggattcttttgattgatcgatgtc 9817438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 104 - 212
Target Start/End: Complemental strand, 9817448 - 9817341
Alignment:
Q  104 tgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaatgagg 203  Q
    ||||||||||||||| ||| ||||||| || |||||||||||||| |||||  |||||||||||| | ||||||||||||| ||||||||||||||||||    
T  9817448 tgatcgatgtcgatc-cagcgatggtggtatgagagaggttggcagcggcggctgagggagaaaactgtgtttagggtttctagagaatgagaaatgagg 9817350  T
Q  204 atgggagga 212  Q
    |||||||||    
T  9817349 atgggagga 9817341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 9817812 - 9817777
Alignment:
Q  1 gaagtttcatgaaaactccatcaaaagagataacca 36  Q
    ||||||||||||||| ||||||||||||||||||||    
T  9817812 gaagtttcatgaaaattccatcaaaagagataacca 9817777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0432 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: scaffold0432
Description:

Target: scaffold0432; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 90 - 240
Target Start/End: Complemental strand, 11708 - 11558
Alignment:
Q  90 atggttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagag 189  Q
    ||||||||||||||  |||||||| |||||||| ||||||| || |||||||||||| | |||   ||||| || |||| ||||||| | | ||||||||    
T  11708 atggttcttttttccaatcgatgttgatctcagcgatggtggtatgagagaggttggtagcgggagttgagagataaaactttgttttgagattcaagag 11609  T
Q  190 aatgagaaatgaggatgggaggattattttgtttgattgatgtccatctca 240  Q
    |||| ||| |||||||||||||||| |||||||||||  ||||| ||||||    
T  11608 aatgggaagtgaggatgggaggattcttttgtttgatcaatgtcgatctca 11558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0432; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 94 - 212
Target Start/End: Complemental strand, 11585 - 11467
Alignment:
Q  94 ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg 193  Q
    ||||||| | ||||| ||||||||||||| | | ||| ||| ||||||||||||| || ||   ||||||||||| | ||| | || ||||| ||||||     
T  11585 ttcttttgtttgatcaatgtcgatctcagcggtagtggtagaagagaggttggcagcgacggccgagggagaaaactgtgtgtgggatttcatgagaata 11486  T
Q  194 agaaatgaggatgggagga 212  Q
    |||||||||||||||||||    
T  11485 agaaatgaggatgggagga 11467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0432; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 11820 - 11788
Alignment:
Q  1 gaagtttcatgaaaactccatcaaaagagataa 33  Q
    |||||||||||||||||||||||||||||||||    
T  11820 gaagtttcatgaaaactccatcaaaagagataa 11788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University