View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10159_low_35 (Length: 266)

Name: NF10159_low_35
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10159_low_35
NF10159_low_35
[»] chr1 (2 HSPs)
chr1 (23-111)||(26534867-26534955)
chr1 (195-257)||(26534731-26534793)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 23 - 111
Target Start/End: Complemental strand, 26534955 - 26534867
Alignment:
Q  23 attagttggtcggtttgttagttgattaagcttcatatatgctatagagctcttgtattctatttcttgcatcttttatcaatatcaaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||    
T  26534955 attagttggtcggtttgttagttgattaagcttcatatatgctatagagctcttgtattttatttcttgtatcttttatcaatatcaaa 26534867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 195 - 257
Target Start/End: Complemental strand, 26534793 - 26534731
Alignment:
Q  195 agatcgttcatcttacaccaacctttctgatgccaccatatactaccccacacacatacattt 257  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  26534793 agatcgttcatcttacaccaacctttctgatgccaccatatactacccctcacacatacattt 26534731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University