View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10154_low_34 (Length: 205)

Name: NF10154_low_34
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10154_low_34
NF10154_low_34
[»] chr1 (1 HSPs)
chr1 (14-189)||(35230733-35230908)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 35230908 - 35230733
Alignment:
Q  14 cataggtgtcagacacggacacggtgtggagatcctaactaggccataaaacgcatcagaaacaatgtcagaaaaaacatgagttaagttgattgattca 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  35230908 cataggtgtcagacacggacacggtgtggagatcctaactaggccataaaacgcatcagaaacaatgtcagaaaaaacatgagttaagtttattgattca 35230809  T
Q  114 gggtttagggtttaacaaacattgcaggtgatagtgtatttagggtataagtttttgtgagtaaaatgagctatat 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35230808 gggtttagggtttaacaaacattgcaggtgatagtgtatttagggtataagtttttgtgagtaaaatgagctatat 35230733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University