View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10153_low_34 (Length: 242)

Name: NF10153_low_34
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10153_low_34
NF10153_low_34
[»] chr5 (2 HSPs)
chr5 (18-106)||(41530800-41530888)
chr5 (188-242)||(41530664-41530724)


Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 106
Target Start/End: Complemental strand, 41530888 - 41530800
Alignment:
Q  18 atattcctatgatataagttaaggggcgaaaaagaaattaacaaataaattgtgtattaaaaatatacgtatttaaatttttaagtttc 106  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  41530888 atattcctgtgatataagttaaggggcgaaaaagaaattaacaaataaattgtgtattgaaaatatacgtatttaaatttttaagtttc 41530800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 242
Target Start/End: Complemental strand, 41530724 - 41530664
Alignment:
Q  188 cttgttctcttaaatgtacttcatct------gatcctaaatataagtaaaaataaaattt 242  Q
    ||||||||||||||||||||||||||      |||||||||||||||||||||||||||||    
T  41530724 cttgttctcttaaatgtacttcatcttcatctgatcctaaatataagtaaaaataaaattt 41530664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University