View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10151_high_36 (Length: 240)

Name: NF10151_high_36
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10151_high_36
NF10151_high_36
[»] chr2 (1 HSPs)
chr2 (97-240)||(9592508-9592651)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 97 - 240
Target Start/End: Original strand, 9592508 - 9592651
Alignment:
Q  97 gttgttggttcacaatcacaactcacaaacacgcttccacttgcacttttgcccatcaaaagatccatataatcatcaatagtcttgatgacctaataaa 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9592508 gttgttggttcacaatcacaactcacaaacacgcttccacttgcacttttgcccatcaaaagatccatataatcatcaatagtcttgatgacctaataaa 9592607  T
Q  197 taattcatccataagcttttgtcttgtgtaagttttcaactggt 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  9592608 taattcatccataagcttttgtcttgtgtaagttttcaactggt 9592651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University