View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10151A_low_197 (Length: 241)

Name: NF10151A_low_197
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10151A_low_197
NF10151A_low_197
[»] chr2 (1 HSPs)
chr2 (26-222)||(38483684-38483881)
[»] chr4 (1 HSPs)
chr4 (103-196)||(30118163-30118257)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 26 - 222
Target Start/End: Original strand, 38483684 - 38483881
Alignment:
Q  26 tattattggagtaagaggtgttttgaaaaattgaaatggcctattgatatcgggagtagttttttcgatggaaatcgtgttgggaagacaggttttgttg 125  Q
    |||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||    
T  38483684 tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatattgggagtagttttttcgatggaaatcgtgttgggaagacgggttttgttg 38483783  T
Q  126 aacggaggtcgttttggaatttg-ttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat 222  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38483784 aacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat 38483881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 103 - 196
Target Start/End: Original strand, 30118163 - 30118257
Alignment:
Q  103 tgttgggaagacaggttttgttgaacggaggtcgttttggaatttgtta-ggagttttgataggctttgggtgatgttgattttgtttcttcaag 196  Q
    |||||| ||||| || |||||||| | ||| |||||||||||| ||||  |||||||||| ||||||||| | |||||| | |||||||||||||    
T  30118163 tgttggtaagaccggatttgttgagcagagatcgttttggaatctgtttcggagttttgacaggctttggattatgttggtgttgtttcttcaag 30118257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University