View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10151A_low_152 (Length: 252)

Name: NF10151A_low_152
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10151A_low_152
NF10151A_low_152
[»] chr1 (2 HSPs)
chr1 (1-216)||(38566802-38567017)
chr1 (2-216)||(38525677-38525891)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 38567017 - 38566802
Alignment:
Q  1 aggtgaagttcttatcgatggaactaacaggaaagaattgcaggtcaggtggatcagagggaaaattggtcttgttagccaggagccagtgttgtttgca 100  Q
    ||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38567017 aggtgaagttcttatcgatggaattaacatgaaagaatttcaggtcaggtggatcagagggaaaattggtcttgttagccaggagccagtgttgtttgca 38566918  T
Q  101 tccagcattaaggataacatttcatacggtaaagatggagcaacgattgaagaaataagatctgcatctgaacttgcaaacgctgccaaattcattgata 200  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  38566917 tccagcattaaggataacatttcatatggtaaagatggagcaacgattgaagagataagatctgcatctgaacttgcaaacgctgccaaattcattgata 38566818  T
Q  201 aactgccacaggttct 216  Q
    ||||||| ||||||||    
T  38566817 aactgccccaggttct 38566802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 2 - 216
Target Start/End: Complemental strand, 38525891 - 38525677
Alignment:
Q  2 ggtgaagttcttatcgatggaactaacaggaaagaattgcaggtcaggtggatcagagggaaaattggtcttgttagccaggagccagtgttgtttgcat 101  Q
    |||||||| ||||||||||||| ||||| ||||||| | ||| | ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||    
T  38525891 ggtgaagtacttatcgatggaattaacatgaaagaacttcagcttaggtggatcagagggaaaattggtcttgtcagccaggagccagtgttatttgcat 38525792  T
Q  102 ccagcattaaggataacatttcatacggtaaagatggagcaacgattgaagaaataagatctgcatctgaacttgcaaacgctgccaaattcattgataa 201  Q
    |||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
T  38525791 ccagcattaaggataacattgcatatggtaaagatggagcaacaattgaagaaataagatctgcatccgaacttgcaaacgccgccaaattcattgataa 38525692  T
Q  202 actgccacaggttct 216  Q
    ||| |||||||||||    
T  38525691 acttccacaggttct 38525677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University