View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_552 (Length: 234)

Name: NF10145A_low_552
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_552
NF10145A_low_552
[»] chr4 (1 HSPs)
chr4 (37-214)||(54428610-54428798)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 37 - 214
Target Start/End: Complemental strand, 54428798 - 54428610
Alignment:
Q  37 catagacttcactctagagttgaaagagtttacttagtacaaaaataactttttatacatccatcattacaatatcnnnnnnngagggaatcactacaat 136  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||       |||||||||| ||||||    
T  54428798 catagacttcactctagagttgaaagagtttacttagtacaaaaataacttcttatacatccatcattacaatatctttttttgagggaatcattacaat 54428699  T
Q  137 atctaaacacaacttaataccatattgttatgagtgtgga-----------ataaaagtggtgcaaatgatgatgacatggcaaataag 214  Q
    ||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||    
T  54428698 atctaaacacaacttaataccatattgttatgagtgtggaatgcccaattgataaaagtggtgcaaatgatgatgacatggcaaataag 54428610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University