View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_536 (Length: 237)

Name: NF10145A_low_536
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_536
NF10145A_low_536
[»] chr3 (1 HSPs)
chr3 (8-226)||(23524057-23524275)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 226
Target Start/End: Complemental strand, 23524275 - 23524057
Alignment:
Q  8 agttcaatccctacatcagtggcgccctcatgtctttcctagccattttcattttcatccatcttctccccttcatcattaccatggtaaccttctactt 107  Q
    ||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23524275 agttcaaaccctacatcagtggggccctcatttctttcctagccattttcattttcatccatcttctccccttcatcattaccatggtaaccttctactt 23524176  T
Q  108 tccactctttttctctactgccctgtttgccgtcgtcatcttcgttttgacaaaaatagccccacccaacattgaccctattcatgtccctagattagct 207  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||  |||||||||||| |||||||||||||||||||||| |||||    
T  23524175 tccactctttttctctactgccctatttgccgtcgtcatcttcgttttgacaaagatcaccccacccaacaatgaccctattcatgtccctagactagct 23524076  T
Q  208 gaagaaatcctcgagtatt 226  Q
    |||||||||||||||||||    
T  23524075 gaagaaatcctcgagtatt 23524057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University