View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_504 (Length: 243)

Name: NF10145A_low_504
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_504
NF10145A_low_504
[»] chr1 (1 HSPs)
chr1 (57-228)||(48632842-48632997)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 57 - 228
Target Start/End: Complemental strand, 48632997 - 48632842
Alignment:
Q  57 atagtgcttaactttccaatccaaattatactcttctcataatgccttttgtctttcatgaatgccattgcaattactttgctggctttatctgaacaca 156  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||                |||||||    
T  48632997 atagtgcttaactttccaatctaaattatactcttctcataatgccttttgtctttcatgaatgccattgcaattac----------------gaacaca 48632914  T
Q  157 ttgtcttgatcaagatctagatttaaaagtaaaaaatcttacgattttgcggtcctactcaccctctctgat 228  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48632913 ttgtcttgatcatgatctagatttaaaagtaaaaaatcttacgattttgcggtcctactcaccctctctgat 48632842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University