View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_499 (Length: 243)

Name: NF10145A_low_499
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_499
NF10145A_low_499
[»] chr1 (1 HSPs)
chr1 (13-243)||(52514672-52514902)


Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 243
Target Start/End: Complemental strand, 52514902 - 52514672
Alignment:
Q  13 acatcacagaaatggagtattaccgtgagaagctgaagaatgatgaagtcatcagtgatgctgtgccacttcgacagcgacttcctgaaccagatactga 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52514902 acataacagaaatggagtattaccgtgagaagctgaagaatgatgaagtcatcagtgatgctgtgccacttcgacagcgacttcctgaaccagatactga 52514803  T
Q  113 catgttgaatgctgaggcagactctcttcaaactccggagcagagtagttcggacggaagtgatgactatgaagatgataaggcgaaggagaaagacttt 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  52514802 catgttgaatgctgaggcagactctcttcaaactccggagcagagtagtttggacggaagtgatgactatgaagatgataaggcgaaggagaaagacttt 52514703  T
Q  213 agtgtggatccgttgcctgttatagggcttg 243  Q
    ||||||||| | |||||||||||||| ||||    
T  52514702 agtgtggattcattgcctgttataggacttg 52514672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University