View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_349 (Length: 255)

Name: NF10145A_low_349
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_349
NF10145A_low_349
[»] chr4 (1 HSPs)
chr4 (7-255)||(32780873-32781121)


Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 7 - 255
Target Start/End: Original strand, 32780873 - 32781121
Alignment:
Q  7 ttggtgttgctgattgattggtcttgaacttgttttctggaaaatttgatgtgcagagccagagacggattattattagtttatggcgaagtcgaggcaa 106  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32780873 ttggtgttgctgattgattggtcttgaacttgttttctggaaaacttgatgtgcagagccagagacggattattattagtttatggcgaagtcgaggcaa 32780972  T
Q  107 aaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaagggaatgggatggtccatctagatgggcagactaccttggaacagaaacga 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  32780973 aaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaagggaatgggatggtccatctagatgggcagactaccttggaacagaaacaa 32781072  T
Q  207 atacggcttctccattgtcgtcaaccagctccaggaatttcggtcatga 255  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  32781073 atacggcttctccattgtcgtcaaccagctccaggaatttcggtcatga 32781121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University