View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_347 (Length: 255)

Name: NF10145A_low_347
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_347
NF10145A_low_347
[»] chr2 (1 HSPs)
chr2 (9-255)||(1329433-1329679)


Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 255
Target Start/End: Original strand, 1329433 - 1329679
Alignment:
Q  9 aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1329433 aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca 1329532  T
Q  109 tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1329533 tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa 1329632  T
Q  209 tgaagtcaaggcccttccaccaccagaggaacccgccgaagaagtgg 255  Q
    || |||||||||||||||||||||||||||||| |||||||||||||    
T  1329633 tgcagtcaaggcccttccaccaccagaggaaccagccgaagaagtgg 1329679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University