View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10142_high_44 (Length: 222)

Name: NF10142_high_44
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10142_high_44
NF10142_high_44
[»] chr8 (2 HSPs)
chr8 (136-208)||(5410851-5410923)
chr8 (1-48)||(5410732-5410779)


Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 136 - 208
Target Start/End: Original strand, 5410851 - 5410923
Alignment:
Q  136 taagatgaaagtgttgtccttgtgcatgaggtagtagctcagtggtaacgggtaagaatttaaccttataact 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5410851 taagatgaaagtgttgtccttgtgcatgaggtagtagctcagtggtaacgggtaagaatttaaccttataact 5410923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 5410732 - 5410779
Alignment:
Q  1 actatatttccaagtctacttattcatcttattaaatccttccctcct 48  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||    
T  5410732 actatatttccaagtccacttattcatcttattaaatccttccctcct 5410779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University