View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10142_high_31 (Length: 247)

Name: NF10142_high_31
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10142_high_31
NF10142_high_31
[»] chr5 (1 HSPs)
chr5 (1-235)||(16008842-16009071)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 16008842 - 16009071
Alignment:
Q  1 gagcggtcgatcttcatggaaactctgggttaagctgtcttaacagagcagcgcccttaaagtagaggtatggcctatgatttatgtatggatcaatcat 100  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||    
T  16008842 gagcggtcgatcttcatggaaactctgggttaagctgacttaacagagcagcgcccttaaagtagaggtatggcctatgatttatgtatgg----atcat 16008937  T
Q  101 ggtccctactccacgaagattggtgccttcccagcctggtcatatacgtatcaaccctcatcttttgtttttcaaatcaatcttggaaggacatatctt- 199  Q
    |||||||||| |||||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  16008938 ggtccctacttcacgaagattggtgccttcccagcatggtc--atacgtatcaaccctcatcttttgtttttcaaatcaatcttggaaggacatatctta 16009035  T
Q  200 atgcagtaagttgagaaaccccagccccttcatctc 235  Q
    ||||||||||||||||| |||||||||||| |||||    
T  16009036 atgcagtaagttgagaagccccagcccctttatctc 16009071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University