View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10140A_low_475 (Length: 213)

Name: NF10140A_low_475
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10140A_low_475
NF10140A_low_475
[»] chr5 (1 HSPs)
chr5 (15-129)||(41424139-41424253)


Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 15 - 129
Target Start/End: Complemental strand, 41424253 - 41424139
Alignment:
Q  15 acatcaaaccaaatttnnnnnnngcaagaaacataaggcatggtgaatttgctttccatcctcaaacagcaacattgaagaagagagcaattaatgccaa 114  Q
    ||||||||||||||||       |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||    
T  41424253 acatcaaaccaaatttaaaaaaagcaagaaacataaggcatggtgaatttgctttccatcctccaacagcaacattgaagatgagagcaattaatgccaa 41424154  T
Q  115 actagagaaagccaa 129  Q
    |||||||||||||||    
T  41424153 actagagaaagccaa 41424139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University