View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10140A_low_444 (Length: 223)

Name: NF10140A_low_444
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10140A_low_444
NF10140A_low_444
[»] chr4 (1 HSPs)
chr4 (33-203)||(20427047-20427209)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 33 - 203
Target Start/End: Original strand, 20427047 - 20427209
Alignment:
Q  33 caagtagcttcaaattcgggaaggtctttccactgaatgaggacctcagcaacaccatc----agtagtgttgcgtacagctttgacatcagcagggaca 128  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    ||||||||||||||||||            |||||||    
T  20427047 caagtagcttcaaattcgggaaggtctttccattgaatgaggacctcagcaacaccatccatcagtagtgttgcgtacagc------------agggaca 20427134  T
Q  129 acttgtaattccatgtcttcagagagcattggcggaagtggttgtggatttgttgagggagaaatagctttcttc 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20427135 acttgtaattccatgtcttcagagagcattggcggaagtggttgtggatttgttgagggagaaatagctttcttc 20427209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University