View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10140A_low_426 (Length: 227)

Name: NF10140A_low_426
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10140A_low_426
NF10140A_low_426
[»] chr2 (2 HSPs)
chr2 (14-227)||(12843680-12843893)
chr2 (7-226)||(12861581-12861800)


Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 12843893 - 12843680
Alignment:
Q  14 gatatgattccggtcagtctctgcaattttctccgtcatcctaaggacaccttcgttggattctggaacgctgctgatcgtagaaggctggagagatttg 113  Q
    |||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12843893 gatatgattccggttagtctctgcaactttctccgtcatcctaagaacaccttcgttggattctggaacgctgctgatcgtagaaggctggagagatttg 12843794  T
Q  114 gtcatcgcttgcaaatgtggaaagatcctcaggatctgaggcattacaggttcaatggtgaaaatctttcacgtgaatcgatgaatgtaattgtggggaa 213  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||    
T  12843793 atcatcgcttgcaaatgtggaaagatcctcaggatctgaggcattacaggttcaatggtgaaaatctttcacgtgaatcgataaatgtaattgtgaggaa 12843694  T
Q  214 ttggcttgatttcg 227  Q
    ||||||||||||||    
T  12843693 ttggcttgatttcg 12843680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 12861581 - 12861800
Alignment:
Q  7 tcgcgcagatatgattccggtcagtctctgcaattttctccgtcatcctaaggacaccttcgttggattctggaacgctgctgatcgtagaaggctggag 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| | |||||||    
T  12861581 tcgcgcagatatgattccggtcagtctctgcaattttctccgtcatcctaagaacaccttcgttggattctggaacgctgcagatcgtaggaagctggag 12861680  T
Q  107 agatttggtcatcgcttgcaaatgtggaaagatcctcaggatctgaggcattacaggttcaatggtgaaaatctttcacgtgaatcgatgaatgtaattg 206  Q
    ||||||| |||||||||||||||||||||| ||||||||||| ||||| |||||  |||||||||||||  ||||||||||  ||||||| ||| |||||    
T  12861681 agatttgatcatcgcttgcaaatgtggaaaaatcctcaggatttgaggaattacgagttcaatggtgaagctctttcacgtttatcgatggatgaaattg 12861780  T
Q  207 tggggaattggcttgatttc 226  Q
    || |||| || |||| ||||    
T  12861781 tgaggaaatgtcttggtttc 12861800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University