View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10140A_low_310 (Length: 245)

Name: NF10140A_low_310
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10140A_low_310
NF10140A_low_310
[»] chr5 (2 HSPs)
chr5 (80-239)||(4119639-4119798)
chr5 (13-81)||(4119340-4119408)


Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 80 - 239
Target Start/End: Original strand, 4119639 - 4119798
Alignment:
Q  80 aataaaacttcatata--ttttttattgaattaattcttatcaagagatatatatgaaacatcacaggcgaacgaggaaaaggcgtttgacgattcatga 177  Q
    ||||||||||||||||  ||||||||||||||| |||||||||||||||||  ||||||||||||||||||||||||||||||| |||||||||||||||    
T  4119639 aataaaacttcatatacattttttattgaattagttcttatcaagagatat--atgaaacatcacaggcgaacgaggaaaaggcatttgacgattcatga 4119736  T
Q  178 caactctgtcgtgacattttagaagcttccgatacggtggtcagagagttcagtttccttga 239  Q
    ||||||||||||||||||||||||| ||| ||||| |||||||| || ||||||||||||||    
T  4119737 caactctgtcgtgacattttagaagattctgatacagtggtcagggaattcagtttccttga 4119798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 13 - 81
Target Start/End: Original strand, 4119340 - 4119408
Alignment:
Q  13 gatgaactttgtggtgacgtttcatgagatatgatgaattgggaacatactgatcatcatagtctagaa 81  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||    
T  4119340 gatgaactttgtggtgacgtttcaggagatatgatgaattgggaacatgctgatcatcatagtctagaa 4119408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University