View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10134_low_18 (Length: 238)

Name: NF10134_low_18
Description: NF10134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10134_low_18
NF10134_low_18
[»] chr1 (2 HSPs)
chr1 (20-84)||(38766346-38766410)
chr1 (193-226)||(38766222-38766255)


Alignment Details
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 38766410 - 38766346
Alignment:
Q  20 ccaactttaaacgtaaatctataaacatgttgaacattattttgactcaaatacattatcaatac 84  Q
    ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  38766410 ccaacgttaaacgtaaatctataaacatgctgaacattattttgactcaaatacattatcaatac 38766346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 226
Target Start/End: Complemental strand, 38766255 - 38766222
Alignment:
Q  193 gtgccgtctatctaatgtgacatgacattaatga 226  Q
    ||||||||||||||||||||||||||||||||||    
T  38766255 gtgccgtctatctaatgtgacatgacattaatga 38766222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University