View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10130_low_7 (Length: 325)

Name: NF10130_low_7
Description: NF10130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10130_low_7
NF10130_low_7
[»] chr7 (1 HSPs)
chr7 (14-156)||(32452700-32452842)
[»] chr1 (1 HSPs)
chr1 (248-314)||(3260783-3260849)


Alignment Details
Target: chr7 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 14 - 156
Target Start/End: Original strand, 32452700 - 32452842
Alignment:
Q  14 atcttcatcatataatctcttttgctatacacattatagctctgtttggtttggattttggctatgccaaccagtattacaagcctcatttatttagaca 113  Q
    ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  32452700 atcttcatcatataatctcttctgctatacaaattatagctctgtttggtttggattttggctatgccaaccagtattacaagcctcatttatgtagaca 32452799  T
Q  114 ttctacatgtcaatcaatggacaatgttttacatggagaatat 156  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  32452800 ttctacatgtcaatcaatggacaatgttttacatggagaatat 32452842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 248 - 314
Target Start/End: Complemental strand, 3260849 - 3260783
Alignment:
Q  248 tatagtattgtaactgtctttctcaatttaaaatttattttttcagtcttcttaattagtatctctg 314  Q
    ||||||||| ||| |||||||||||||||||||||||| ||| || |||||||||  ||||||||||    
T  3260849 tatagtattataaatgtctttctcaatttaaaatttatatttgcaatcttcttaacgagtatctctg 3260783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University