View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10129_low_88 (Length: 249)

Name: NF10129_low_88
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10129_low_88
NF10129_low_88
[»] chr2 (1 HSPs)
chr2 (9-249)||(35235438-35235678)


Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 35235678 - 35235438
Alignment:
Q  9 acgtaggctgttcgacgagagtgacacttctaaggttattgagggaaataacggcaatgttacaatgagataggggtgacaatgactgtcacataatatt 108  Q
    |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35235678 acgtaggctgttcgacgagagtgaaagttctaaggttattgagggaaataacggcaatgttacaatgagataggggtgacaatgactgtcacataatatt 35235579  T
Q  109 tatgatggcgttgttacttgtcacacaaaaataggggctagtccaaaaacaacatcgttcaaagtacaaaggcagcttttgttatcataagaaacttcgt 208  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  35235578 tatgatggcgttgttacttgttacacaaaaataggggctagtccaaaaacaacatcgttcaaagtacaaaggcaacttttgttatcataagaaacttcgt 35235479  T
Q  209 tttgtccaatatcttgataatgtcaaatagatatgggactt 249  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  35235478 tttgtccaatatcttgataatgtcaaatagatatgggactt 35235438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University