View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10129_low_66 (Length: 263)

Name: NF10129_low_66
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10129_low_66
NF10129_low_66
[»] chr7 (3 HSPs)
chr7 (133-185)||(9699650-9699702)
chr7 (14-73)||(9699702-9699761)
chr7 (217-252)||(9699558-9699593)
[»] chr4 (3 HSPs)
chr4 (133-185)||(13566027-13566079)
chr4 (14-73)||(13566079-13566138)
chr4 (217-252)||(13565935-13565970)


Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 9699702 - 9699650
Alignment:
Q  133 tatattaatctaacaacttctaacatttatcatttaaaaaatatatattgtca 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9699702 tatattaatctaacaacttctaacatttatcatttaaaaaatatatattgtca 9699650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 9699761 - 9699702
Alignment:
Q  14 ctttcatcctagaggttcttctggagaagtcgtcaattgggtgagattgctaatttgatt 73  Q
    ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||    
T  9699761 ctttcatcctagaggctcttctggagaattcgtcaattgggtgagattgctaatttgatt 9699702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 217 - 252
Target Start/End: Complemental strand, 9699593 - 9699558
Alignment:
Q  217 tgtctgcgcccctcgattacttttttgtcctttcat 252  Q
    ||||||||||||||||||||||||||||||||||||    
T  9699593 tgtctgcgcccctcgattacttttttgtcctttcat 9699558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 13566079 - 13566027
Alignment:
Q  133 tatattaatctaacaacttctaacatttatcatttaaaaaatatatattgtca 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13566079 tatattaatctaacaacttctaacatttatcatttaaaaaatatatattgtca 13566027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 13566138 - 13566079
Alignment:
Q  14 ctttcatcctagaggttcttctggagaagtcgtcaattgggtgagattgctaatttgatt 73  Q
    ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||    
T  13566138 ctttcatcctagaggctcttctggagaattcgtcaattgggtgagattgctaatttgatt 13566079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 217 - 252
Target Start/End: Complemental strand, 13565970 - 13565935
Alignment:
Q  217 tgtctgcgcccctcgattacttttttgtcctttcat 252  Q
    ||||||||||||||||||||||||||||||||||||    
T  13565970 tgtctgcgcccctcgattacttttttgtcctttcat 13565935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University