View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10125_high_47 (Length: 202)

Name: NF10125_high_47
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10125_high_47
NF10125_high_47
[»] chr4 (1 HSPs)
chr4 (13-186)||(51961448-51961621)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 51961448 - 51961621
Alignment:
Q  13 gcatagggatgaagggtgttctgttcttgccaaaatggaagggtggaagcctctaactttggcggttgaaagaaaagtgccttgtctttgatttgttgaa 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51961448 gcatggggatgaagggtgttctgttcttgccaaaatggaagggtggaagcctctaactttggcggttgaaagaaaagtgccttgtctttgatttgttgaa 51961547  T
Q  113 taatgttgactttgagcttgattgcaaaatattggtggatgcttttcacaacccaaagatgatgtctcagagtt 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51961548 taatgttgactttgagcttgattgcaaaatattggtggatgcttttcacaacccaaagatgatgtctcagagtt 51961621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University