View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10125_high_41 (Length: 232)

Name: NF10125_high_41
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10125_high_41
NF10125_high_41
[»] chr6 (1 HSPs)
chr6 (1-232)||(32997033-32997264)


Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 32997264 - 32997033
Alignment:
Q  1 tattgttgatgatcaaacaagagtttccaggacttccacagtcttcacttgatatcagcaaaatccaatacagcaaggtgataacaacgttacactctta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  32997264 tattgttgatgatcaaacaagagtttccaggacttccacagtcttcacttgatatcagcaaaatccaatacaacaaggtgataacaacgttacactctta 32997165  T
Q  101 tctgaattattgtttgactcacttttatctaagtttatccaaacaccgataactttacattaaaatcacttcttacggaaattaactttacaaaatcaaa 200  Q
    |||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  ||||||||    
T  32997164 tctgaattattgttcgactcacttttatctgaatttatccaaacaccgataactttacattaaactcacttcttacggaaattaactttatgaaatcaaa 32997065  T
Q  201 tttcgctagcacaaaaccaaacatggactaat 232  Q
    ||||||||  |||||| ||| ||| |||||||    
T  32997064 tttcgctacaacaaaatcaagcatagactaat 32997033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University