View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10124_14 (Length: 315)

Name: NF10124_14
Description: NF10124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10124_14
NF10124_14
[»] chr8 (2 HSPs)
chr8 (164-241)||(3688727-3688804)
chr8 (238-311)||(3688621-3688694)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 164 - 241
Target Start/End: Complemental strand, 3688804 - 3688727
Alignment:
Q  164 ttcaccttcacgagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttcacttttcc 241  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  3688804 ttcaccttcaggagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttgacttttcc 3688727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 238 - 311
Target Start/End: Complemental strand, 3688694 - 3688621
Alignment:
Q  238 ttccctcattcttctcactcccaaacgaaaacggtaatgatgatccataccgcaatgtttcatattgttgcggc 311  Q
    |||| |||||||| ||||||||||||||||| ||||| ||| ||| ||||||||| ||||||||||||||||||    
T  3688694 ttccttcattcttttcactcccaaacgaaaatggtaacgataatctataccgcaaagtttcatattgttgcggc 3688621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University