View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10119_low_24 (Length: 252)

Name: NF10119_low_24
Description: NF10119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10119_low_24
NF10119_low_24
[»] chr8 (2 HSPs)
chr8 (26-103)||(29373356-29373433)
chr8 (187-236)||(29373517-29373566)
[»] chr2 (1 HSPs)
chr2 (40-103)||(45086632-45086695)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 26 - 103
Target Start/End: Original strand, 29373356 - 29373433
Alignment:
Q  26 attgataaacacagttgtctccacaaggatgatgattaattaaattcctcgtcaatcatgattttacttaggtgatag 103  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||    
T  29373356 attgataaacacagttgtctccacaaggatgatgattagttaaattcctcgtcaatcatgattttacttgggtgatag 29373433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 187 - 236
Target Start/End: Original strand, 29373517 - 29373566
Alignment:
Q  187 ttagtattgttttaattatctctttgtcactctttggtaattgaggttct 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29373517 ttagtattgttttaattatctctttgtcactctttggtaattgaggttct 29373566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 103
Target Start/End: Complemental strand, 45086695 - 45086632
Alignment:
Q  40 ttgtctccacaaggatgatgattaattaaattcctcgtcaatcatgattttacttaggtgatag 103  Q
    ||||||||||||| ||  |||||||||||||  |||| |||||||||||| |||||||||||||    
T  45086695 ttgtctccacaagaattgtgattaattaaataactcggcaatcatgatttaacttaggtgatag 45086632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University