View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10119_high_7 (Length: 353)

Name: NF10119_high_7
Description: NF10119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10119_high_7
NF10119_high_7
[»] chr2 (1 HSPs)
chr2 (1-262)||(7422863-7423124)


Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 7423124 - 7422863
Alignment:
Q  1 tgcaaaatattaataagcatacgtc-gcttgatttaacacttcatgcgagcagacagatggttgtgattggctcttgttcgagggccataatccatgtac 99  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  7423124 tgcaaaatattaataagcatacgtcagcttgatttaacacttcatgcgagcagacagatggttgtgattggcccttgttcgagggccataatccatgtac 7423025  T
Q  100 tgtgaatactttggggagtgtggtggatatgcatttgatttttggatccttgcaaacacccaaggcccactgttctacccttacgtaatgattgaatgat 199  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  7423024 tgtgaatattttggggagtgtggtggatatgcatttgatttttggatccttgcaaacacccaaggcccactgttctaccctt-cgtaatgattgaatgat 7422926  T
Q  200 ggtgacggtggtgatggcgatggcgatggtgctagtgctgctaatattgccaatgtcgaagtc 262  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  7422925 ggtgacggtggtgatggcgatggtgatggtgctagtgctgctaatattgccaatgtcgaagtc 7422863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University