View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10117_high_11 (Length: 247)

Name: NF10117_high_11
Description: NF10117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10117_high_11
NF10117_high_11
[»] chr5 (1 HSPs)
chr5 (33-229)||(4673081-4673275)


Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 33 - 229
Target Start/End: Complemental strand, 4673275 - 4673081
Alignment:
Q  33 cacttcttcacacttgatgtatgtgttatcgtgtttcttccactatactattccttatgaaaagagtaaagaagaggaccagggtacaaccaagcaaaag 132  Q
    ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  4673275 cacttcttcacacttgatgtatgtgttatcgtgttttctccactatactattccttatgaaaagagtaaagaagaggaccaggatacaaccaagcaaaag 4673176  T
Q  133 tggtgaaatggattgagagaaaaggaagcaaacttgtaaacaaacatttttgaaaaagacacacaatttggaagctgcatgcgtccctgcgccgtca 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||  ||||||||||||||||||||||||||||||||||||    
T  4673175 tggtgaaatggattgagagaaaaggaagcaaacttgtaaacaaacatttgtgaaaaaga--cacaatttggaagctgcatgcgtccctgcgccgtca 4673081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University