View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10111_low_25 (Length: 286)

Name: NF10111_low_25
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10111_low_25
NF10111_low_25
[»] chr2 (1 HSPs)
chr2 (52-274)||(16081217-16081434)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 52 - 274
Target Start/End: Complemental strand, 16081434 - 16081217
Alignment:
Q  52 aacatagaaatgcaaacacatttactcattacataaataaattggctttacttaatcatgacagaaattggaagaagaaaactccaaattgtatttcaaa 151  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||    
T  16081434 aacatagaaatgcaaacacagttactcattacataaataaattggctttacttaatgatgacagaaattggaaggagaaaactccaaattgtatttcaaa 16081335  T
Q  152 cattgttgtacaagattggttaccgttttaag-ttgaatggaaagcaaaagcagtctcttgcaagagattaacaaactaactacaatactcaaagctaac 250  Q
    |||||||||||||||||||||||||||||||| ||||||||      |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16081334 cattgttgtacaagattggttaccgttttaagtttgaatgg------aaagcagtctcttgcaagagattaacaaactaactacaatactcaaagctaac 16081241  T
Q  251 aaacttctaacacacttcaaccta 274  Q
    |||||||||| |||||||||||||    
T  16081240 aaacttctaaaacacttcaaccta 16081217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University