View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10110_2D_high_30 (Length: 217)

Name: NF10110_2D_high_30
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10110_2D_high_30
NF10110_2D_high_30
[»] chr1 (2 HSPs)
chr1 (80-199)||(3613305-3613424)
chr1 (4-47)||(3613457-3613500)
[»] chr3 (2 HSPs)
chr3 (82-199)||(14757108-14757225)
chr3 (16-83)||(14757272-14757339)


Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 80 - 199
Target Start/End: Complemental strand, 3613424 - 3613305
Alignment:
Q  80 gagttttgatgcattagctctttcatccgatcatatggcattcgtgttatttgccaatatctcgtgatcagctcaggacgtggagtcgcacgacctgtag 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3613424 gagttttgatgcattagctctttcatccgatcatatggcattcgtgttatttgccaatatctcgtgatcagctcaggacgtggagtcgcacgacctgtag 3613325  T
Q  180 caggtgtgacaggattaatt 199  Q
    ||||||||||||||||||||    
T  3613324 caggtgtgacaggattaatt 3613305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 4 - 47
Target Start/End: Original strand, 3613457 - 3613500
Alignment:
Q  4 catttgagtctgcacctgggacaactctgtttgctgactggggt 47  Q
    ||||||||||| ||||||||||||||||||||||||||||||||    
T  3613457 catttgagtctacacctgggacaactctgtttgctgactggggt 3613500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 82 - 199
Target Start/End: Complemental strand, 14757225 - 14757108
Alignment:
Q  82 gttttgatgcattagctctttcatccgatcatatggcattcgtgttatttgccaatatctcgtgatcagctcaggacgtggagtcgcacgacctgtagca 181  Q
    |||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||| ||| |  ||||| || |||||    
T  14757225 gttttgctgcatcagttctttcatccgatcatatggcattcgtgttatttgccaatatcgtgtgatcagctcaggacgcggattaacacgaactatagca 14757126  T
Q  182 ggtgtgacaggattaatt 199  Q
    ||||||||||||||||||    
T  14757125 ggtgtgacaggattaatt 14757108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 14757272 - 14757339
Alignment:
Q  16 cacctgggacaactctgtttgctgactggggtataggtcctgcacttggggtggctgatccaaagagt 83  Q
    |||||||||||||||||||||||||||||||||||||||||||  |||| | ||||||||||||||||    
T  14757272 cacctgggacaactctgtttgctgactggggtataggtcctgctgttggagaggctgatccaaagagt 14757339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University