View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10110_1D_low_23 (Length: 250)

Name: NF10110_1D_low_23
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10110_1D_low_23
NF10110_1D_low_23
[»] chr3 (1 HSPs)
chr3 (1-244)||(32259237-32259480)


Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 32259237 - 32259480
Alignment:
Q  1 ggtttgatattgatctatcaagggaggagaccttacgaggcaacggaaatgtctcactttcatttaattcccagggggtgttgaaaatttgtgtaaaaaa 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32259237 ggtttgatattgatctatcaatggaggagaccttacgaggcaacggaaatgtctcactttcatttaattcccagggggtgttgaaaatttgtgtaaaaaa 32259336  T
Q  101 tgatagaaatgttggctcttatggcattttttctggagataatccatttgatttcactcttccggcaacattgttccaaatcatcgttattgtcgtcctc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  32259337 tgatagaaatgttggctcttatggcattttttctggagataatccattcgatttcactcttccggcaacattgttccaaatcatcattattgtcgtcctc 32259436  T
Q  201 tctcaaactctttactttcttctcaggccattacgaacaccaaa 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  32259437 tctcaaactctttactttcttctcaggccattacgaacaccaaa 32259480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University