View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10103_low_77 (Length: 241)

Name: NF10103_low_77
Description: NF10103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10103_low_77
NF10103_low_77
[»] chr4 (1 HSPs)
chr4 (1-225)||(6373764-6373994)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 6373994 - 6373764
Alignment:
Q  1 tgattccttgcgatttaagaaacggatggttgaattgcaagaatctcctttatcatataaaatgttttgaggtagcagcactttgttgcacctctttttg 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
T  6373994 tgattccttgcgatttaagaaacagatggttgaattgcaagaatctcctttatcatataaaatgtt--gaggtagcagcactttgttgcacctctttttg 6373897  T
Q  101 gtttaaaaaata-----------gatgatccctaaaacaattagggtggaaaagggaaatggtacataagaataccgagactaccatttttagaaatgat 189  Q
    ||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  6373896 gtttaaaaaataaataaaaaatagatgatccctaaaacaattagggtggaaaagggaaatggtacataagaatactgagactaccatttttagaaatgat 6373797  T
Q  190 tgattagtagtaaacaaaagcagaaagtattataac 225  Q
    |||||   ||||||||||||| ||||||||||||||    
T  6373796 tgatt---agtaaacaaaagcggaaagtattataac 6373764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University