View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10101_low_10 (Length: 384)

Name: NF10101_low_10
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10101_low_10
NF10101_low_10
[»] chr6 (3 HSPs)
chr6 (17-114)||(5266657-5266754)
chr6 (253-325)||(5059278-5059350)
chr6 (285-321)||(5168671-5168707)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 5266754 - 5266657
Alignment:
Q  17 gatgccaaacttgtttgtgacaatgaacacacttttatgcaaatttatgctgattttgcgacacaaataagaccatagtagtggcacaaatcaaactg 114  Q
    |||||| |||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5266754 gatgccgaacttgtttgcgacaatgaacacacttttatgcaaagttacgctgattttgcgacacaaataagaccatagtagtggcacaaatcaaactg 5266657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 253 - 325
Target Start/End: Original strand, 5059278 - 5059350
Alignment:
Q  253 tccagtttttaaaacattggtacaaagtgaatgttcaaacttttcttaagggatgattttacaatgagaaaac 325  Q
    |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| || |||||||    
T  5059278 tccagtttttaaaacattggcacaaagtgaatgttcatacttttcttaagggatgattttaccataagaaaac 5059350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 285 - 321
Target Start/End: Original strand, 5168671 - 5168707
Alignment:
Q  285 gttcaaacttttcttaagggatgattttacaatgaga 321  Q
    |||||||||||| ||||| ||||||||||||||||||    
T  5168671 gttcaaactttttttaagtgatgattttacaatgaga 5168707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University