View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10099_low_7 (Length: 305)

Name: NF10099_low_7
Description: NF10099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10099_low_7
NF10099_low_7
[»] chr4 (2 HSPs)
chr4 (15-193)||(40078541-40078720)
chr4 (251-293)||(40078504-40078546)


Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 40078720 - 40078541
Alignment:
Q  15 agaaagaagacgggaaaaaa-taggagattgttgtttaataagagataaatagaaagnnnnnnnntacgagagaaaataaagaagtatatttatgtgaat 113  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||    
T  40078720 agaaagaagacgggaaaaaaataggagattgttgtttaataagagataaatagaaagaaaaaaaatacgagagaaaataaagaagtatatttatgtgaat 40078621  T
Q  114 tcatacttgcatgttttttaaaatgtgaattcattcactatattttgtgtttggaactttcaaaatttacatgagtgaat 193  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||    
T  40078620 tcatacttgcatgttttttaaaatgtgaattcattcactacattttgtgtttggaactttaaaaatttacatgagtgaat 40078541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 251 - 293
Target Start/End: Complemental strand, 40078546 - 40078504
Alignment:
Q  251 gtgaattgattgagtaaaaaatgagtgaatcgtttaactcctt 293  Q
    ||||||||||| ||| |||||| ||||||||||||||||||||    
T  40078546 gtgaattgattcagtcaaaaataagtgaatcgtttaactcctt 40078504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University