View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10098_low_23 (Length: 279)

Name: NF10098_low_23
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10098_low_23
NF10098_low_23
[»] chr7 (1 HSPs)
chr7 (2-261)||(32134971-32135230)


Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 2 - 261
Target Start/End: Original strand, 32134971 - 32135230
Alignment:
Q  2 gtcgtcgtcgccgccgtgagagttccaatcgcagcggtgacattgaactaggttttcggtgaagcaacgaactgaagcggcgtcgtttttgcagttttga 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32134971 gtcgtcgtcgccgccgtgagagttccaatcgcagcggtgacattgaactaggttttcggtgaagcaacgaactgaagcggcgtcgtttttgcagttttga 32135070  T
Q  102 cagatttggaaacgcacgtgcttgagtgcgagtgcgtttgcggagtgcacgtgctggtcgcaaactaaacagagtttcgcggagtctggtttgcaatata 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32135071 cagatttggaaacgcacgtgcttgagtgcgagtgcgtttgcggagtgcacgtgctggtcgcaaactaaacagagtttcgcggagtctggtttgcaatata 32135170  T
Q  202 gcaccgcgcttcttgtgtcgcaatagtcacacggaaacgacatcgttttaggaggatact 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32135171 gcaccgcgcttcttgtgtcgcaatagtcacacggaaacgacatcgttttaggaggatact 32135230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University