View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10098_low_16 (Length: 386)

Name: NF10098_low_16
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10098_low_16
NF10098_low_16
[»] chr8 (2 HSPs)
chr8 (45-192)||(13976417-13976564)
chr8 (335-371)||(13976587-13976623)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 3e-61; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 45 - 192
Target Start/End: Original strand, 13976417 - 13976564
Alignment:
Q  45 gtgtcatgtcatgctgtcatgaaatcttaaccacaggatggatgagatgattcacagtctgacttgaataaatagattttaaattataaacttaaataat 144  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  13976417 gtgtcatgtcatgctgtcaggaaatcttaaccacaggatggatgagatgattcacagtctgacttgattaaatagattttaaattataaacttaaataat 13976516  T
Q  145 cgaataactagtctatacaattgcacgcaggaatacctgatttacact 192  Q
    |||| ||||||| |||||||||||| ||||  ||||||||||||||||    
T  13976517 cgaagaactagtttatacaattgcatgcagagatacctgatttacact 13976564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 335 - 371
Target Start/End: Original strand, 13976587 - 13976623
Alignment:
Q  335 tgtatatatacattaatcagggcccttagtcccttac 371  Q
    ||||||||||||||||||||||| |||||||||||||    
T  13976587 tgtatatatacattaatcagggcacttagtcccttac 13976623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University