View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10092A_low_353 (Length: 213)

Name: NF10092A_low_353
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10092A_low_353
NF10092A_low_353
[»] chr7 (1 HSPs)
chr7 (52-181)||(47358642-47358771)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 52 - 181
Target Start/End: Original strand, 47358642 - 47358771
Alignment:
Q  52 atttgtacaaagctttacaagtcaggcagacccaccagagatggcctaaaaggacagtgatgatgaaccacatgcatgcatgtttatgtttatctataat 151  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47358642 atttatacaaagctttacaagtcaggcagacccaccagagatggcctaaaaggacagtgatgatgaaccacatgcatgcatgtttatgtttatctataat 47358741  T
Q  152 agcaaaactttagggtactcatcatgtaat 181  Q
    ||||||||||||||||||||||||||||||    
T  47358742 agcaaaactttagggtactcatcatgtaat 47358771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University