View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10092A_low_278 (Length: 232)

Name: NF10092A_low_278
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10092A_low_278
NF10092A_low_278
[»] chr8 (2 HSPs)
chr8 (9-199)||(28251220-28251410)
chr8 (194-229)||(28252127-28252162)


Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 9 - 199
Target Start/End: Original strand, 28251220 - 28251410
Alignment:
Q  9 agatggacatcagaaaagcttttgacactcttgaatggtattttatgctaaaagttcttagaagctttggtttcaatgaagctttttgcaaatggattct 108  Q
    |||| ||||| |||||||||||||| |||||||||||||||||  ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||    
T  28251220 agattgacattagaaaagcttttgatactcttgaatggtatttcctgctaaaagtttttagaagctttggtttcaatgaagctttttgaaaatggattct 28251319  T
Q  109 agttattttaagattatcttttctctcagtttccattaatgggaaatctcatggttatttcaatgctactagagggttcaggcagggggat 199  Q
    ||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  28251320 agttactttaaaatcatcttttctctcagtttccattaatgggaaatctcatggttatttcaatgctactagagggttcaggaagggggat 28251410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 229
Target Start/End: Original strand, 28252127 - 28252162
Alignment:
Q  194 ggggattctctttacctacttctattttgcttagtt 229  Q
    ||||||||||||| ||||||||||||||||||||||    
T  28252127 ggggattctctttccctacttctattttgcttagtt 28252162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University