View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10092A_low_158 (Length: 262)

Name: NF10092A_low_158
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10092A_low_158
NF10092A_low_158
[»] chr6 (3 HSPs)
chr6 (6-212)||(23332595-23332801)
chr6 (207-249)||(23322331-23322373)
chr6 (207-249)||(23332498-23332540)


Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 212
Target Start/End: Complemental strand, 23332801 - 23332595
Alignment:
Q  6 ctgagatgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcagg 105  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  23332801 ctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcagg 23332702  T
Q  106 agtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtc 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  23332701 agtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtc 23332602  T
Q  206 cacatat 212  Q
    || ||||    
T  23332601 catatat 23332595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
Q  207 acatatgcgtttggattttacaacgattgtgtttggtgatgtc 249  Q
    ||||||||||||||| ||||||||| |||||||||||||||||    
T  23322373 acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc 23322331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
Q  207 acatatgcgtttggattttacaacgattgtgtttggtgatgtc 249  Q
    ||||||||||||||| ||||||||| |||||||||||||||||    
T  23332540 acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc 23332498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University