View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10092A_high_51 (Length: 223)

Name: NF10092A_high_51
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10092A_high_51
NF10092A_high_51
[»] chr5 (1 HSPs)
chr5 (9-223)||(33119722-33119938)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 33119722 - 33119938
Alignment:
Q  9 agatgaatcaaattgtggcttctgtgcttccaccgatagggtaaacaaagtagtttaaatttattatgctctt--atatattcattgttgttaagagctt 106  Q
    |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||  |||||||||| |||||||||||||     
T  33119722 agatgaatcaaattgtggcttctgtgattccaccgataaggtaaacaaagtagtttaaatttattatgctcttgtatatattcatcgttgttaagagctc 33119821  T
Q  107 ttatacataatcttgtatcgaatgttggttttgcagctaaaaccaggggcatgcttaatccaagatgacgcgtctaaggagcgttgcgaatcacagcata 206  Q
    ||||||||||||||||||| |||||||| ||||||||||||||| ||||||| |||||||||||| ||||| ||||||||||| |||| |||||| || |    
T  33119822 ttatacataatcttgtatcaaatgttgggtttgcagctaaaaccgggggcatacttaatccaagacgacgcatctaaggagcgctgcgcatcacaacaca 33119921  T
Q  207 gggattggtacacacaa 223  Q
    | |||||||||||||||    
T  33119922 gagattggtacacacaa 33119938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University