View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10080_high_43 (Length: 258)

Name: NF10080_high_43
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10080_high_43
NF10080_high_43
[»] chr4 (2 HSPs)
chr4 (122-186)||(36680082-36680146)
chr4 (14-124)||(36686625-36686740)


Alignment Details
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 122 - 186
Target Start/End: Original strand, 36680082 - 36680146
Alignment:
Q  122 tgatgtcagtatgtagtagctctgaacacccggcattgagaacttcctttgcttgctctgtctgt 186  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  36680082 tgatgtcagtatgtagtagctctgaacacccggcgttgagaacttcctttgcttgctctgtctgt 36680146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 14 - 124
Target Start/End: Original strand, 36686625 - 36686740
Alignment:
Q  14 aagcagagaacttacagaaataaggagaaacataggaaacgatacaattaacgcatgaaagagag------aaatgaagaataacacgtgaccattttta 107  Q
    |||||||||||||| | ||||||||| || || ||||||||||| ||||| ||| ||||| | ||      |||||||||||||||||||||||||| ||    
T  36686625 aagcagagaacttatacaaataaggataagcagaggaaacgataaaatta-cgcgtgaaacacagttacacaaatgaagaataacacgtgaccatttata 36686723  T
Q  108 aacaacattccatgtga 124  Q
    |||||||||||||||||    
T  36686724 aacaacattccatgtga 36686740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University