View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10078_high_17 (Length: 241)

Name: NF10078_high_17
Description: NF10078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10078_high_17
NF10078_high_17
[»] chr3 (2 HSPs)
chr3 (125-224)||(36048989-36049088)
chr3 (1-70)||(36049143-36049212)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 125 - 224
Target Start/End: Complemental strand, 36049088 - 36048989
Alignment:
Q  125 tttttcacatggatcaaaagaagaagaaaacaataactaccttccataggctgatgattgttgttctcaggcaaatcagcgtgtggcacgagcacttctt 224  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  36049088 tttttcacatggatcaaaaaaagaagaaaacaataactaccttccataggctgatgattgttgttctcgggcaaatcagcgtgtggcacgagcacttctt 36048989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 36049212 - 36049143
Alignment:
Q  1 tgtcctcacaatccaaaaactatgttgtaacacgggggaatgggatcttttgaagcaattcaattacatc 70  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  36049212 tgtcttcacaatccaaaaactatgttgtaacacgggggaatgggatcttttgaagcaatttaattacatc 36049143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University