View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10077_low_28 (Length: 209)

Name: NF10077_low_28
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10077_low_28
NF10077_low_28
[»] chr4 (1 HSPs)
chr4 (18-163)||(48249888-48250033)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 48250033 - 48249888
Alignment:
Q  18 gggggtttgatggattgaagaaatggaagagaaatgaattggatgatgatgagactgctcctttgcctctgaatcagagatctgatagtgaggctttctc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48250033 gggggtttgatggattgaagaaatggaagagaaatgaattggatgatgatgagactgctcctttgcctctgaatcagagatctgatagtgaggctttctc 48249934  T
Q  118 agcttcatctcagtcttttgcaagagcagttggcgatggaccggat 163  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||    
T  48249933 agcttcatctcagtcttttgcaagagcagttggcgatgggccggat 48249888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University