View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10076_low_9 (Length: 243)

Name: NF10076_low_9
Description: NF10076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10076_low_9
NF10076_low_9
[»] chr4 (1 HSPs)
chr4 (14-225)||(41097976-41098187)


Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 41098187 - 41097976
Alignment:
Q  14 aaggagaaaatctcagaaagactttcaaatgtagagaatctatggtttccacgcgcacaacaatccaccgcaacactcccttctcaacgcaaatccatct 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  41098187 aaggagaaaatctcagaaagactttcaaatgtagagaatctatggtttccacgcgcacaacaatccaccgccacactcccttctcaacgcaaatccatct 41098088  T
Q  114 tccactctcttctcacccgcgacccatccctcttcctagaacgctacggttccaatctcacttccaccgaattaaccgaattcgaaaccctaaaagaaga 213  Q
    |||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41098087 tccactctcttctcactcgcgacccatctctcttcctagaacgctacggttccaatctcacttccaccgaattaaccgaattcgaaaccctaaaagaaga 41097988  T
Q  214 ttacgagattaa 225  Q
    ||||||||||||    
T  41097987 ttacgagattaa 41097976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University