View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10074_low_23 (Length: 238)

Name: NF10074_low_23
Description: NF10074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10074_low_23
NF10074_low_23
[»] chr4 (2 HSPs)
chr4 (74-224)||(8472322-8472470)
chr4 (92-162)||(6224979-6225049)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 74 - 224
Target Start/End: Original strand, 8472322 - 8472470
Alignment:
Q  74 ttacatctacactaaatgaaaaacggtttaattcaacattaaatttatcaactacagttctccactcccataacataatgacatgatataaatgctaaat 173  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8472322 ttacatctacactaaatgaaagacggtttaattcaacattaaatttatcaactacagttctccactcccataacataatgacatgatataaatgctaaat 8472421  T
Q  174 gagaagaatgaaatagaatgttattacagagaacaacgggaggtttatgtt 224  Q
    |||||||||||||||||||||||||||||||||||||  ||||||||||||    
T  8472422 gagaagaatgaaatagaatgttattacagagaacaac--gaggtttatgtt 8472470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 92 - 162
Target Start/End: Complemental strand, 6225049 - 6224979
Alignment:
Q  92 aaaaacggtttaattcaacattaaatttatcaactacagttctccactcccataacataatgacatgatat 162  Q
    |||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||| ||||    
T  6225049 aaaagcggtttaattcaacactaaatttatcaactacagttctctactcccataacttaatgacataatat 6224979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University