View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10070_low_83 (Length: 213)

Name: NF10070_low_83
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10070_low_83
NF10070_low_83
[»] chr2 (1 HSPs)
chr2 (58-183)||(38249057-38249182)
[»] chr1 (1 HSPs)
chr1 (58-129)||(14227901-14227972)
[»] chr8 (1 HSPs)
chr8 (74-129)||(37810852-37810907)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 58 - 183
Target Start/End: Original strand, 38249057 - 38249182
Alignment:
Q  58 tggtgagtagattgcaaaacgacggcggaattggtggggaaagggggcgatgacgaccccttgtatagtggataatgaatcggatagataaagaatcaat 157  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||    
T  38249057 tggtgagtagcatgcaaaacgacggcggaattggtggggaaagggggcgacgacgaccccttgtatagtggatattgaatcggatagatgaagaatcaat 38249156  T
Q  158 agtatccttatgagtttagtttagtt 183  Q
    ||||| || |||||||||||||||||    
T  38249157 agtattctcatgagtttagtttagtt 38249182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 129
Target Start/End: Original strand, 14227901 - 14227972
Alignment:
Q  58 tggtgagtagattgcaaaacgacggcggaattggtggggaaagggggcgatgacgaccccttgtatagtgga 129  Q
    ||||||||||  ||| ||||||||| |||||||||||||||||||||||| |  || ||||||||| |||||    
T  14227901 tggtgagtagcatgcgaaacgacggtggaattggtggggaaagggggcgacggtgatcccttgtatggtgga 14227972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 129
Target Start/End: Original strand, 37810852 - 37810907
Alignment:
Q  74 aaacgacggcggaattggtggggaaagggggcgatgacgaccccttgtatagtgga 129  Q
    ||||||||||| |||||||||||||||||| ||| | | ||||||||||| |||||    
T  37810852 aaacgacggcgaaattggtggggaaaggggacgacggcaaccccttgtatggtgga 37810907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University