View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10060_high_16 (Length: 216)

Name: NF10060_high_16
Description: NF10060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10060_high_16
NF10060_high_16
[»] chr7 (1 HSPs)
chr7 (1-215)||(3981405-3981619)


Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 3981619 - 3981405
Alignment:
Q  1 tttttcaatctaattcaaagatcaaatgattgtattctaaagagacaatccaattgaggccttggagcaaccccctaacttcaccctcagatgctctcat 100  Q
    |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3981619 ttttgcaatctaattcaaagatcacatgattgtattctaaagagacaatccaattgaggccttggagcaaccccctaacttcaccctcagatgctctcat 3981520  T
Q  101 aacaacactacatattaaactggtgcaacaatggggcttggcctaaccaagctggcaaccatttgtataaatgattgtagctcaagtccaaggacgacaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  3981519 aacaacactacatattaaactggtgcaacaatggggcttggcctaaccaagctggcaaccatttgtataaatgattgtagctcaagtccaaggatgacaa 3981420  T
Q  201 gatcgggatatcttc 215  Q
    |||||||||||||||    
T  3981419 gatcgggatatcttc 3981405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University