View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10053_low_24 (Length: 229)

Name: NF10053_low_24
Description: NF10053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10053_low_24
NF10053_low_24
[»] chr4 (1 HSPs)
chr4 (7-149)||(39144085-39144227)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 7 - 149
Target Start/End: Original strand, 39144085 - 39144227
Alignment:
Q  7 tatgttgcagactattgatgataatagcattgagcaaagggtcttgctaacaatgcactaaatgcatcattttccagacaaagtttcaaaaatagaaata 106  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  39144085 tatgttgcagactattgatgataatagcagtgtgcaaagggtcttgctaacaatgcactaaatgcatcattttcaagacaaagtttcaaaaatagaaata 39144184  T
Q  107 attggtaaattttaactatttaaagaaaaatagttccaatgca 149  Q
    || ||| ||||| |||||||||||||||| |||||||||||||    
T  39144185 atcggtgaatttcaactatttaaagaaaactagttccaatgca 39144227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University