View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10052_low_26 (Length: 205)

Name: NF10052_low_26
Description: NF10052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10052_low_26
NF10052_low_26
[»] chr1 (1 HSPs)
chr1 (44-192)||(23945057-23945205)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 44 - 192
Target Start/End: Complemental strand, 23945205 - 23945057
Alignment:
Q  44 ctttccactttaatccactcaccatgcaaagaatccggttcaccattaatacccaagatatcagttttgaacggaaactcctccatcattattcctgatt 143  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  23945205 ctttccactttaatccactcaccatgcaaagaatccggttcaccattaatacccaagatatcagttttgaacggaatctcctccatcattattcctgatt 23945106  T
Q  144 tttcgtttttaccgttacccacattaaagttgttaccgttcttctctgt 192  Q
    ||||||||||||||||||||||||||| ||||||| ||||||| |||||    
T  23945105 tttcgtttttaccgttacccacattaatgttgttatcgttcttgtctgt 23945057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University